circad | circRNAs associated with diseases

Hsa_circ_0000673
Gene	RSL1D1	Organism	Human
Genome Locus	chr16:11940357-11940700:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30061181
Experimental Method
Sample Type	Tissue and blood samples	Comparison	Normal gastric tissues 3 cm from the margin of resected neoplastic tissues of patients with GC were isolated and confirmed by pathological evaluation. We also collected 38 plasma samples from 14 healthy donors and 24 patients with GC
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTATAGGTGGAACAGTCTTAA Reverse TTATATTCCTTCTTTAGAGTTTGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Chang, P, Wang, F, Li, Y (2018). Hsa_circ_0000673 is down-regulated in gastric cancer and inhibits the proliferation and invasion of tumor cells by targetting miR-532-5p. Biosci. Rep., 38, 5:no page given.